eGFP-luciferase-C1
(Plasmid #163523)

• Purpose: Expresses both eGFP and firefly luciferase in mammalian cells
• Depositing Lab: Thomas Weber
• Publication: Expression plasmid for production of murine IFN gamma (unpublished)

Backbone

• Vector backbone: eGFP-C1
• Backbone manufacturer: Conetech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 6366
• Vector type: Mammalian Expression, Bacterial Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Species: Fire Fly
• Insert Size (bp): 1688
• Tag / Fusion Protein:
  • eGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho1 (unknown if destroyed)
• 3′ cloning site: BamH1 (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned by Ananda Mookerjee and Thomas Weber