katushka-FMDV-P2A-pTRIP
(Plasmid #163522)

• Purpose: Used to construct lentivirus to express katushka in mammalian cells with option for a second insert
• Depositing Lab: Thomas Weber
• Publication: Expression plasmid for production of murine IFN gamma (unpublished)

Backbone

• Vector backbone: pTRIP-Puro-2A
• Backbone manufacturer: Addgene
• Modifications to backbone: Multiple cloning sites added
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: stopless Katushka-P2A
• Alt name: TurboFP635-P2A
• Species: Synthetic
• Insert Size (bp): 840

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (unknown if destroyed)
• 3′ cloning site: BamH1 (unknown if destroyed)
• 5′ sequencing primer: TCAGATCGCCTGGAGACGCCATCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned by Ananda Mookerjee and Thomas Weber