mu-IFNg-pCIneo
(Plasmid
#163517)
-
PurposeExpresses murine IFN gamma in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
-
Modifications to backboneChanged multiple cloning site
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemurine-IFN gamma
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)548
-
GenBank IDNM_008337
-
Entrez GeneIfng (a.k.a. IFN-g, If2f, Ifg)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Not1 (unknown if destroyed)
- 5′ sequencing primer CGTTTAGTGAACCGTCAGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid created by Ananda Mookerjee and Thomas Weber
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mu-IFNg-pCIneo was a gift from Thomas Weber (Addgene plasmid # 163517 ; http://n2t.net/addgene:163517 ; RRID:Addgene_163517)