Skip to main content
Addgene

pWZL Hygro-NMYC TRF2 deltaB
(Plasmid #16349)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 16349 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pWZL Hygro NMYC
  • Backbone size w/o insert (bp) 5900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTRF2
  • Alt name
    human TTAGGG repeat binding factor 2
  • Alt name
    2433
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1368
  • Mutation
    Deleted Basic Domain (aa1-44)
  • Entrez Gene
    TERF2 (a.k.a. TRBF2, TRF2)
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL Hygro-NMYC TRF2 deltaB was a gift from Titia de Lange (Addgene plasmid # 16349 ; http://n2t.net/addgene:16349 ; RRID:Addgene_16349)

  • For your References section:

    Different telomere damage signaling pathways in human and mouse cells. Smogorzewska A, de Lange T. EMBO J. 2002 Aug 15. 21(16):4338-48. 10.1093/emboj/cdf433 PubMed 12169636
Related items:
Commonly requested with: