AiP1051-pAAV-Synapsin promoter-oNigri-WPRE-hGHpA
(Plasmid
#163489)
-
PurposeDirect-expressing oNigri AAV Virus
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Synapsin promoter-Cre-WPRE-bGHpA
-
Backbone manufacturerAllen Institute
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoNigri
-
SpeciesSynthetic
-
Insert Size (bp)1401
- Promoter Synapsin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CACCACCTGTCAGCTCCTTT
- 3′ sequencing primer AAGGGAGATCCGACTCGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Funded by BRAIN initiative.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AiP1051-pAAV-Synapsin promoter-oNigri-WPRE-hGHpA was a gift from The Allen Institute for Brain Science & Tanya Daigle (Addgene plasmid # 163489 ; http://n2t.net/addgene:163489 ; RRID:Addgene_163489)