pLentiCRISPR-v1-sgMPC2_9
(Plasmid
#163458)
-
Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPR v1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA 9 targeting GPT2
-
gRNA/shRNA sequenceGTGTAGGGGTTGGTGTGTGC
-
SpeciesH. sapiens (human)
-
Entrez GeneMPC2 (a.k.a. BRP44)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTTTTAAAATGGACTATCATATGCTTACCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR-v1-sgMPC2_9 was a gift from Jason Cantor (Addgene plasmid # 163458 ; http://n2t.net/addgene:163458 ; RRID:Addgene_163458) -
For your References section:
CRISPR screens in physiologic medium reveal conditionally essential genes in human cells. Rossiter NJ, Huggler KS, Adelmann CH, Keys HR, Soens RW, Sabatini DM, Cantor JR. Cell Metab. 2021 Feb 23. pii: S1550-4131(21)00061-9. doi: 10.1016/j.cmet.2021.02.005. 10.1016/j.cmet.2021.02.005 PubMed 33651980