pAd-PV-NLS-CD-DsRed
(Plasmid #16345)

• Depositing Lab: Anton Bennett
• Publication: Rodrigues et al J Biol Chem. 2007 Jun 8. 282(23):17061-8.

Backbone

• Vector backbone: Adenoviral Recombinant (pAdEasy)
• Backbone size w/o insert (bp): 33400
• Vector type: Mammalian Expression, Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PV-DsRed-NLS-CD
• Alt name: Parvalbumin
• Species: R. norvegicus (rat)
• Insert Size (bp): 1100
• Mutation: Functional Ca2+binding site CD was inactivated by substituting a glutamate for a valine residue at position 12 of Ca2+ binding loop
• GenBank ID: M12725
• Entrez Gene: Pvalb (a.k.a. PALB1, Pva)
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GTGGCAAAAGTGACGTTTTTGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AdEasy is a registered trademark of the Johns Hopkins University.