Skip to main content
Addgene

eSpCas9(1.1)-ABL1-gRNA1-exon4
(Plasmid #163322)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163322 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    eSpCas9(1.1) AddGene plasmid #71814
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8500
  • Modifications to backbone
    Used BbsI sites to insert 20bp gRNA
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ABL1 gRNA 1_Exon4
  • Alt name
    guide RNA targeting c-Abl
  • gRNA/shRNA sequence
    GGGGGACACACCATAGACAG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AddGene, eSpCas9(1.1) plasmid #71814

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)-ABL1-gRNA1-exon4 was a gift from Val Brunton (Addgene plasmid # 163322 ; http://n2t.net/addgene:163322 ; RRID:Addgene_163322)

  • For your References section:

    Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors. Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG. Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373. 10.1158/0008-5472.CAN-21-0373 PubMed 34921014
Related items: