PX459v2-ILK-gRNA 1-exon 1
(Plasmid #163320)

• Purpose: SpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.
• Depositing Lab: Val Brunton
• Publication: Beetham et al Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373.

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
• Backbone size w/o insert (bp): 9200
• Total vector size (bp): 9200
• Modifications to backbone: Used BbsI sites to insert 21bp gRNA
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ILK gRNA 1_Exon1
• Alt name: guide RNA targeting Integrin-Linked Kinase
• gRNA/shRNA sequence: G*CGGAGAACGACCTCAACCAG
• Species: H. sapiens (human)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (not destroyed)
• 3′ cloning site: BbsI (not destroyed)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: AddGene, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry