pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
(Plasmid #163176)

• Purpose: Lentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tag
• Depositing Lab: Sok Ching Cheong
• Publication: Chai et al Elife. 2020 Sep 29;9. pii: 57761. doi: 10.7554/eLife.57761.

Backbone

• Vector backbone: pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
• Total vector size (bp): 8650
• Modifications to backbone: Used BbsI enzyme to clone in gRNA targeting human WWTR1 gene
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: WWTR1
• Alt name: TAZ
• gRNA/shRNA sequence: GAATCCGAAGCCTAGCTCG
• Species: H. sapiens (human)
• Entrez Gene: WWTR1 (a.k.a. TAZ)
• Promoter: U6
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: AGATAATTAGAATTAATTTGACTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry