pUHG10.3-TetO-Rs1
(Plasmid #16313)

• Depositing Lab: Bruce Conklin
• Publication: Hsiao et al Proc Natl Acad Sci U S A. 2008 Jan 29. 105(4):1209-14.

Backbone

• Vector backbone: pUHG10-3
• Backbone size w/o insert (bp): 3705
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: h5HT4b Serotonin Receptor (Rs1 D100A RASSL)
• Alt name: Rs1
• Alt name: D100A
• Alt name: 5HT4
• Species: H. sapiens (human)
• Insert Size (bp): 1745
• Mutation: Added FLAG tag; Changed Aspartic Acid 100 to Alanine.
• Entrez Gene: RS1 (a.k.a. RS, XLRS1)
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCACGCTGTTTTGACCTCC
• 3′ sequencing primer: CCCTGAAAACTTTGCCCCCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry