pJW2171
(Plasmid #163095)

• Purpose: CRISPR repair template: add insertion site specific homology arms by PCR before insertion
• Depositing Lab: Jordan Ward
• Publication: Ashley et al Genetics. 2021 Mar 31;217(3). pii: 6104563. doi: 10.1093/genetics/iyab006.

Backbone

• Vector backbone: pDONR221
• Backbone size w/o insert (bp): 2360
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 1269
• Mutation: Silent mutations to remove piRNA sites

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • pJW2171 (30xlinker-mNeonGreen (dpi)-degron 3xFLAG-linker).gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.05.12.090217v1 for bioRxiv preprint.