pHis-Hgd
(Plasmid
#163091)
-
PurposeExpressing mouse Hgd in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163091 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHis parallel
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5554
- Total vector size (bp) 6992
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHgd
-
Alt namepHis-Hgd
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1338
-
Entrez GeneHgd (a.k.a. Hgo, aku)
- Promoter T7
-
Tag
/ Fusion Protein
- his (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer gttagcagccggatctcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-Hgd was a gift from Joseph Takahashi (Addgene plasmid # 163091 ; http://n2t.net/addgene:163091 ; RRID:Addgene_163091) -
For your References section:
Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. Yang S, Siepka SM, Cox KH, Kumar V, de Groot M, Chelliah Y, Chen J, Tu B, Takahashi JS. Proc Natl Acad Sci U S A. 2019 Oct 29;116(44):22229-22236. doi: 10.1073/pnas.1904485116. Epub 2019 Oct 14. 10.1073/pnas.1904485116 PubMed 31611405