pcDNA-Fah_S
(Plasmid
#163086)
-
PurposeSwingshift mutant FAH in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5506
- Total vector size (bp) 6764
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameFah_S
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1258
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc-His (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFah_S
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1258
-
Tag
/ Fusion Protein
- Myc-His (C terminal on insert)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-Fah_S was a gift from Joseph Takahashi (Addgene plasmid # 163086 ; http://n2t.net/addgene:163086 ; RRID:Addgene_163086) -
For your References section:
Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. Yang S, Siepka SM, Cox KH, Kumar V, de Groot M, Chelliah Y, Chen J, Tu B, Takahashi JS. Proc Natl Acad Sci U S A. 2019 Oct 29;116(44):22229-22236. doi: 10.1073/pnas.1904485116. Epub 2019 Oct 14. 10.1073/pnas.1904485116 PubMed 31611405