Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mtagBFP2-CaM-uTEVp
(Plasmid #163033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BFP-CaM-uTEVp
  • Species
    Synthetic
  • Promoter Synapsin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGACCATCTGCGCTGCGGCGCC
  • 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mtagBFP2-CaM-uTEVp was a gift from Alice Ting (Addgene plasmid # 163033 ; http://n2t.net/addgene:163033 ; RRID:Addgene_163033)
  • For your References section:

    A Molecular Calcium Integrator Reveals a Striatal Cell Type Driving Aversion. Kim CK, Sanchez MI, Hoerbelt P, Fenno LE, Malenka RC, Deisseroth K, Ting AY. Cell. 2020 Dec 23;183(7):2003-2019.e16. doi: 10.1016/j.cell.2020.11.015. Epub 2020 Dec 11. 10.1016/j.cell.2020.11.015 PubMed 33308478