-
PurposeControl tet-inducible shRNA targeting eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTet-pLKO-puro
- Backbone size w/o insert (bp) 8762
- Total vector size (bp) 8816
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEnhanced Green Fluorescent Protein
-
Alt nameeGFP
-
gRNA/shRNA sequenceTACAACAGCCACAACGTCTAT
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original backbone from Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504
Addgene #21915
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP shRNA tet pLKO puro was a gift from Mark Rubin (Addgene plasmid # 163017 ; http://n2t.net/addgene:163017 ; RRID:Addgene_163017) -
For your References section:
Mapping of m6A and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-low Induction of Therapy Resistance. Cotter KA, Gallon J, Uebersax N, Rubin P, Meyer KD, Piscuoglio S, Jaffrey SR, Rubin MA. Mol Cancer Res. 2021 Jun 4. pii: 1541-7786.MCR-21-0014. doi: 10.1158/1541-7786.MCR-21-0014. 10.1158/1541-7786.MCR-21-0014 PubMed 34088870