Skip to main content
Addgene

pAT9753-BEAR-mScarlet-preedited
(Plasmid #162994)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162994 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mScarlet split with an intron between amino acids 110-111
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGCGTGTACGGTGGG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT9753-BEAR-mScarlet-preedited was a gift from Ervin Welker (Addgene plasmid # 162994 ; http://n2t.net/addgene:162994 ; RRID:Addgene_162994)

  • For your References section:

    BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors. Talas A, Simon DA, Kulcsar PI, Varga E, Krausz SL, Welker E. Nat Commun. 2021 Nov 3;12(1):6353. doi: 10.1038/s41467-021-26461-y. 10.1038/s41467-021-26461-y PubMed 34732717
Related items:
Commonly requested with: