Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

METTL3 shRNA 1 tet pLKO puro
(Plasmid #162985)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162985 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone size w/o insert (bp) 8762
  • Total vector size (bp) 8816
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    methyltransferase like 3
  • Alt name
    METTL3
  • gRNA/shRNA sequence
    GCAAGTATGTTCACTATGAAA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_019852
  • Entrez Gene
    METTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original backbone from Dmitri Wiederschain (Addgene plasmid # 21915)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    METTL3 shRNA 1 tet pLKO puro was a gift from Mark Rubin (Addgene plasmid # 162985 ; http://n2t.net/addgene:162985 ; RRID:Addgene_162985)
  • For your References section:

    Mapping of m6A and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-low Induction of Therapy Resistance. Cotter KA, Gallon J, Uebersax N, Rubin P, Meyer KD, Piscuoglio S, Jaffrey SR, Rubin MA. Mol Cancer Res. 2021 Jun 4. pii: 1541-7786.MCR-21-0014. doi: 10.1158/1541-7786.MCR-21-0014. 10.1158/1541-7786.MCR-21-0014 PubMed 34088870