Skip to main content
Addgene

pmCherry-N1 GBP (GBP-mCherry)
(Plasmid #162879)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162879 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pmCherry-N1
  • Backbone manufacturer
    Clontec
  • Total vector size (bp) 5043
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP Binding Protein
  • Alt name
    GBP, GFP Nanobody, abGFP4
  • Insert Size (bp)
    1078
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV F)
  • 3′ sequencing primer TTGGTCACCTTCAGCTTGG (mCherry R)
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GBP insert was derived from pOPINE GFP nanobody (Plasmid #49172)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-N1 GBP (GBP-mCherry) was a gift from Frederic Meunier (Addgene plasmid # 162879 ; http://n2t.net/addgene:162879 ; RRID:Addgene_162879)

  • For your References section:

    Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152
Related items:
Commonly requested with: