Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
(Plasmid #162877)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmEos2-N1
  • Backbone manufacturer
    EGFP replaced with mEos2 in pEGFP-N1 backbone (Clontec)
  • Backbone size w/o insert (bp) 4694
  • Total vector size (bp) 5198
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pleckstrin homology domain of PLCδ1 (phospholipase C-δ1)
  • Alt name
    PH-PLCd
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    510
  • Mutation
    Insert consists of AA1-170
  • GenBank ID
    NM_006225.4
  • Entrez Gene
    PLCD1 (a.k.a. NDNC3, PLC-III)
  • Tag / Fusion Protein
    • mEos2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg (CMV F)
  • 3′ sequencing primer TGTACCATCTCCGTCGATCA (mEos2 R)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2) was a gift from Frederic Meunier (Addgene plasmid # 162877 ; http://n2t.net/addgene:162877 ; RRID:Addgene_162877)
  • For your References section:

    Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152