pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
(Plasmid #162877)

• Purpose: Expression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALM
• Depositing Lab: Frederic Meunier
• Publication: Gormal et al Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117.

Backbone

• Vector backbone: pmEos2-N1
• Backbone manufacturer: EGFP replaced with mEos2 in pEGFP-N1 backbone (Clontec)
• Backbone size w/o insert (bp): 4694
• Total vector size (bp): 5198
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pleckstrin homology domain of PLCδ1 (phospholipase C-δ1)
• Alt name: PH-PLCd
• Species: H. sapiens (human)
• Insert Size (bp): 510
• Mutation: Insert consists of AA1-170
• GenBank ID: NM_006225.4
• Entrez Gene: PLCD1 (a.k.a. NDNC3, PLC-III)
• Tag / Fusion Protein:
  • mEos2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg (CMV F)
• 3′ sequencing primer: TGTACCATCTCCGTCGATCA (mEos2 R)

Resource Information

• Supplemental Documents:
  • pmEos2-N1 PHPLCd (PHPLCd-mEos2).gbk
• A portion of this plasmid was derived from a plasmid made by: PH-PLCd insert was derived from PH-PLCD1-GFP (Plasmid #51407).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry