pPodA11
(Plasmid
#162843)
-
PurposeExpression protein designed PodA10 from a TEV cleavable IPTG inducible plasmid with ampicillin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTEV16
- Backbone size w/o insert (bp) 5334
- Total vector size (bp) 5838
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein Designed Pyocyanin demethylase
-
Alt namePodA10
-
SpeciesMycolicibacterium fortuitum subsp. fortuitum DSM 46621 = ATCC 6841
-
Insert Size (bp)369
-
MutationA53N, I73T, A87V, M99V, A129T from WT PodA
-
GenBank IDMFORT_14352
- Promoter T7
-
Tag
/ Fusion Protein
- TEV-cleavable 6x-His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (destroyed during cloning)
- 3′ cloning site BspQI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPodA11 was a gift from Dianne Newman (Addgene plasmid # 162843 ; http://n2t.net/addgene:162843 ; RRID:Addgene_162843) -
For your References section:
Computationally designed pyocyanin demethylase acts synergistically with tobramycin to kill recalcitrant Pseudomonas aeruginosa biofilms. VanDrisse CM, Lipsh-Sokolik R, Khersonsky O, Fleishman SJ, Newman DK. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12). pii: 2022012118. doi: 10.1073/pnas.2022012118. 10.1073/pnas.2022012118 PubMed 33723058