Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFBP-2_6m.mutant
(Plasmid #162842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162842 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS1748
  • Backbone manufacturer
    https://doi.org/10.1093/nar/gks636
  • Backbone size w/o insert (bp) 8187
  • Total vector size (bp) 8305
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    2_6m_RNA-device
  • Species
    Synthetic; Tobacco ringspot virus
  • Insert Size (bp)
    123
  • GenBank ID
    2_6m_RNA-device

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBP-2_6m.mutant was a gift from Matthias Heinemann (Addgene plasmid # 162842 ; http://n2t.net/addgene:162842 ; RRID:Addgene_162842)
  • For your References section:

    A synthetic RNA-based biosensor for fructose-1,6-bisphosphate that reports glycolytic flux. Ortega AD, Takhaveev V, Vedelaar SR, Long Y, Mestre-Farras N, Incarnato D, Ersoy F, Olsen LF, Mayer G, Heinemann M. Cell Chem Biol. 2021 Apr 22. pii: S2451-9456(21)00161-6. doi: 10.1016/j.chembiol.2021.04.006. 10.1016/j.chembiol.2021.04.006 PubMed 33915105