Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW-SPIC
(Plasmid #162825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162825 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene plasmid pCW-Cas9 (plasmid#50661)
  • Backbone size w/o insert (bp) 7600
  • Total vector size (bp) 8353
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SPIC
  • Species
    H. sapiens (human)
  • Entrez Gene
    SPIC (a.k.a. SPI-C)
  • Promoter Tet ON

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pCW Seq F: AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer pCW Seq R: GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SPIC was amplified from commercial cDNAs and switched with Cas9 from Addgene plasmid pCW-Cas9 (plasmid #50661).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-SPIC was a gift from Matthew Steinhauser (Addgene plasmid # 162825 ; http://n2t.net/addgene:162825 ; RRID:Addgene_162825)
  • For your References section:

    Prolonged fasting drives a program of metabolic inflammation in human adipose tissue. Fazeli PK, Zhang Y, O'Keefe J, Pesaresi T, Lun M, Lawney B, Steinhauser ML. Mol Metab. 2020 Sep 28;42:101082. doi: 10.1016/j.molmet.2020.101082. 10.1016/j.molmet.2020.101082 PubMed 32992039