-
PurposeExpressess an optimized construct of human rhinovirus 14 3C protease (NT*-HRV3CP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-47b(+)
- Backbone size w/o insert (bp) 5011
- Total vector size (bp) 6004
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman rhinovirus 14 3C protease
-
Alt nameNT*-HRV3CP
-
SpeciesHuman rhinovirus 14 3C
-
Insert Size (bp)993
-
GenBank IDNP_740524.1
- Promoter T7
-
Tag
/ Fusion Protein
- NT* solubility tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-NT*-HRV3CP was a gift from Gottfried Otting (Addgene plasmid # 162795 ; http://n2t.net/addgene:162795 ; RRID:Addgene_162795) -
For your References section:
NT*-HRV3CP: an optimized construct of human rhinovirus 14 3C protease for high-yield expression and fast affinity-tag cleavage. Abdelkader EH, Otting G. J Biotechnol. 2020 Nov 6. pii: S0168-1656(20)30306-0. doi: 10.1016/j.jbiotec.2020.11.005. 10.1016/j.jbiotec.2020.11.005 PubMed 33166527