Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTF-ACE2s
(Plasmid #162786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162786 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p1.1
  • Backbone manufacturer
    LMBT, LTD
  • Backbone size w/o insert (bp) 11914
  • Total vector size (bp) 7436
  • Modifications to backbone
    Truncated EEF1A1 DFR and UFR sequences; FLAG-tag and 10xHis-tag coding sequences added
  • Vector type
    Mammalian Expression
  • Selectable markers
    HT/MTX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Angiotensin-converting enzyme 2
  • Alt name
    ACE-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2235
  • GenBank ID
    NM_021804
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
  • Tags / Fusion Proteins
    • hTPA leader (N terminal on insert)
    • FLAG (C terminal on backbone)
    • 10xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AbsI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
  • 3′ sequencing primer IRESA rev aggtttccgggccctcacattg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ACE-2 extracellular domain was obtained using a PCR-product kindly provided by Petr V. Sergiev (Lomonosov Moscow State University, Moscow, Russia)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTF-ACE2s was a gift from Ivan Vorobiev (Addgene plasmid # 162786 ; http://n2t.net/addgene:162786 ; RRID:Addgene_162786)
  • For your References section:

    Fast and Accurate Surrogate Virus Neutralization Test Based on Antibody-Mediated Blocking of the Interaction of ACE2 and SARS-CoV-2 Spike Protein RBD. Kolesov DE, Sinegubova MV, Dayanova LK, Dolzhikova IV, Vorobiev II, Orlova NA. Diagnostics (Basel). 2022 Feb 3;12(2). pii: diagnostics12020393. doi: 10.3390/diagnostics12020393. 10.3390/diagnostics12020393 PubMed 35204485