Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTM-RBDv2
(Plasmid #162785)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162785 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p1.1
  • Backbone manufacturer
    LMBT, LTD
  • Backbone size w/o insert (bp) 11914
  • Total vector size (bp) 7436
  • Modifications to backbone
    Truncated EEF1A1 DFR and UFR sequences; hTPA signal peptide, c-myc, and 10xHis coding sequences added
  • Vector type
    Mammalian Expression
  • Selectable markers
    HT/MTX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 S protein receptor binding domain (RBD)
  • Alt name
    SARS-CoV-2 Spike protein RBD
  • Alt name
    SARS-CoV-2 Surface glycoprotein RBD
  • Species
    Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
  • Insert Size (bp)
    660
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
  • Tags / Fusion Proteins
    • hTPA leader (N terminal on backbone)
    • c-myc (C terminal on backbone)
    • 10xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XmaI (destroyed during cloning)
  • 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
  • 3′ sequencing primer IRESArev aggtttccgggccctcacattg; SQ-MycH-R gatgaccgcctgcagac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert was synthesized according to https://www.nature.com/articles/s41591-020-0913-5, we excluded Lys319 from the N-terminus of the mature RBD protein, aiming at the maximization of signal peptide processing, and removed C-terminal amino acid residues Cys538-Val-Asn-Phe541

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTM-RBDv2 was a gift from Ivan Vorobiev (Addgene plasmid # 162785 ; http://n2t.net/addgene:162785 ; RRID:Addgene_162785)
  • For your References section:

    High-level expression of the monomeric SARS-CoV-2 S protein RBD 320-537 in stably transfected CHO cells by the EEF1A1-based plasmid vector. Sinegubova MV, Orlova NA, Kovnir SV, Dayanova LK, Vorobiev II. PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021. 10.1371/journal.pone.0242890 PubMed 33529230