pET15b/GVcl 1-1066 /*TBM
(Plasmid
#162781)
-
Purposeamplification of Gallus gallus Vcl mutated in Tankyrase Binding Domain II
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET15b/GVcl 1-1066 (Addgene #46171)
- Total vector size (bp) 8909
-
Modifications to backboneG454V
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGallus gallus vinculin
-
Alt nameVCL
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)3198
-
Mutationchanged Gly 454 to Val
-
Entrez GeneVCL (a.k.a. VINC1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCGACGACATGGGAAAGTAGACTCTCCTGAGGCCCGT
- 3′ sequencing primer ACGGGCCTCAGGAGAGTCTACTTTCCCATGTCGTCGCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received the plasmid bearing WT GgVcl from addgene, and then mutated it.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET15b/GVcl 1-1066 /*TBM was a gift from Laura Lafon-Hughes (Addgene plasmid # 162781 ; http://n2t.net/addgene:162781 ; RRID:Addgene_162781) -
For your References section:
First evidences suggesting a role of a tankyrase-binding motif (TBM) of vinculin (VCL) in epithelial cells. Vilchez-Larrea, S, Valsecchi W, Fernández-Villamil S, and Lafon Hughes L. PeerJ