pWZL Hygro-NFLAG TRF1 deltaA
(Plasmid
#16278)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 16278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWZL Hygro NFLAG
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTRF1
-
Alt namehuman TTAGGG repeat binding factor 1
-
Alt name2421
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1116
-
MutationDeleted acidic domain (aa1-66)
-
GenBank IDNM_017489
-
Entrez GeneTERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTTTGTACACCCTAAGCCT
- 3′ sequencing primer AATGCTCGTCAAGAAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL Hygro-NFLAG TRF1 deltaA was a gift from Titia de Lange (Addgene plasmid # 16278 ; http://n2t.net/addgene:16278 ; RRID:Addgene_16278) -
For your References section:
Different telomere damage signaling pathways in human and mouse cells. Smogorzewska A, de Lange T. EMBO J. 2002 Aug 15. 21(16):4338-48. 10.1093/emboj/cdf433 PubMed 12169636
Map uploaded by the depositor.
