pET24a-LaM4-1xTS
(Plasmid #162778)

• Purpose: Bacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to one tyrosine sulfation (TS) motif. LaM4-1xTS also contains a T7, HA, BAP and His6 epitope
• Depositing Lab: Martin Spiess
• Publication: Buser et al Life Sci Alliance. 2022 Mar 21;5(7). pii: 5/7/e202101269. doi: 10.26508/lsa.202101269. Print 2022 Mar.

Backbone

• Vector backbone: pET24a
• Backbone manufacturer: Merck - Novagen
• Total vector size (bp): 5810
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: anti-mCherry nanobody fused to a TS site, T7, HA, BAP and His6 epitope
• Alt name: LaM4
• Species: Synthetic
• Insert Size (bp): 600
• Promoter: T7
• Tags / Fusion Proteins:
  • T7 (N terminal on insert)
  • HA (C terminal on insert)
  • BAP (C terminal on insert)
  • His6 (C terminal on insert)
  • TS site from proCCK (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vectors are based on Buser et al., 2018 (PNAS), and Buser and Spiess, 2019 (JoVE) (https://www.addgene.org/Martin_Spiess/) The anti-mCherry nanobody sequence (LaM4) is based on Fridy et al., 2014 (Nature Methods)