pET24a-LaM4-3xTS
(Plasmid
#162777)
-
PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to three tyrosine sulfation (TS) motifs. LaM4-3xTS also contains a T7, HA, BAP and His6 epitope
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET24a
-
Backbone manufacturerMerck - Novagen
- Total vector size (bp) 5858
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameanti-mCherry nanobody fused to three TS sites, T7, HA, BAP and His6 epitope
-
Alt nameLaM4
-
SpeciesSynthetic
-
Insert Size (bp)648
- Promoter T7
-
Tags
/ Fusion Proteins
- T7 (N terminal on insert)
- HA (C terminal on insert)
- BAP (C terminal on insert)
- His6 (C terminal on insert)
- TS site from proCCK (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vectors are based on Buser et al., 2018 (PNAS), and Buser and Spiess, 2019 (JoVE) (https://www.addgene.org/Martin_Spiess/) The anti-mCherry nanobody sequence (LaM4) is based on Fridy et al., 2014 (Nature Methods)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET24a-LaM4-3xTS was a gift from Martin Spiess (Addgene plasmid # 162777 ; http://n2t.net/addgene:162777 ; RRID:Addgene_162777) -
For your References section:
Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies. Buser DP, Bader G, Spiess M. Life Sci Alliance. 2022 Mar 21;5(7). pii: 5/7/e202101269. doi: 10.26508/lsa.202101269. Print 2022 Mar. 10.26508/lsa.202101269 PubMed 35314489