p1.1-mCherry
(Plasmid
#162772)
-
PurposeFluorescent reporter for CHO expression studies
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size w/o insert (bp) 11914
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersHT/MTX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namered fluorescent protein
-
Alt namemCherry
-
SpeciesSynthetic; Anaplasma marginale
-
Insert Size (bp)804
-
Mutationconsensus Kozak sequence (GCCGCCATGG) added before the ORF
-
GenBank IDKJ567138
- Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AbsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESA rev aggtttccgggccctcacattg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert made by PCR with pmCherry-N1 (Clontech) as a template
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1.1-mCherry was a gift from Ivan Vorobiev (Addgene plasmid # 162772 ; http://n2t.net/addgene:162772 ; RRID:Addgene_162772) -
For your References section:
Approaches to Controlled Co-Amplification of Genes for Production of Biopharmaceuticals: Study of the Insertion and Amplification Dynamics of Genetic Cassettes in the Genome of Chinese Hamster Ovary Cells during Co-Expression of Compatible Pair of Plasmids. Kovnir SV, Orlova NA, Khodak Ycapital A, Cyrillic, Kondrashova MP, Gabibov AG, Skryabin KG, Vorobiev AI, Vorobiev II. Bull Exp Biol Med. 2017 Jun;163(2):245-249. doi: 10.1007/s10517-017-3776-0. Epub 2017 Jul 18. 10.1007/s10517-017-3776-0 PubMed 28726207