Skip to main content
Addgene

pU6 SgRNA RBM20
(Plasmid #162735)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162735 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MLM3636, BPK1520
  • Backbone manufacturer
    Joung lab (Addgene Plasmid #65777)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spacer sequence for RBM20
  • gRNA/shRNA sequence
    GGTCTCGTAGTCCGGTGAGC
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6 SgRNA RBM20 was a gift from Amit Choudhary (Addgene plasmid # 162735 ; http://n2t.net/addgene:162735 ; RRID:Addgene_162735)
  • For your References section:

    Chemogenetic System Demonstrates That Cas9 Longevity Impacts Genome Editing Outcomes. Sreekanth V, Zhou Q, Kokkonda P, Bermudez-Cabrera HC, Lim D, Law BK, Holmes BR, Chaudhary SK, Pergu R, Leger BS, Walker JA, Gifford DK, Sherwood RI, Choudhary A. ACS Cent Sci. 2020 Dec 23;6(12):2228-2237. doi: 10.1021/acscentsci.0c00129. Epub 2020 Nov 18. 10.1021/acscentsci.0c00129 PubMed 33376784