Skip to main content
Addgene

pCCM’ CbbQ-
(Plasmid #162711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162711 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFA31 (derived from pZA31 expressing under PLtet0-1 and constitutive tetR)
  • Backbone size w/o insert (bp) 2980
  • Total vector size (bp) 14585
  • Modifications to backbone
    The p15A origin was replaced with high-copy colE1 origin.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Second CCM operon cloned from H. neapolitanus
  • Species
    Halothiobacillus neapolitanus
  • Insert Size (bp)
    11605
  • Mutation
    Inactivation of CbbQ subunit of CbbOQ rubisco activase (CbbQ K46A, E107Q)
  • Promoter PLtet0-1 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaacctcttacgtgccgatc
  • 3′ sequencing primer GCGTTCACCGACAAACAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Inactivation of CbbQ subunit of CbbOQ rubisco activase in pCCM'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCCM’ CbbQ- was a gift from David Savage (Addgene plasmid # 162711 ; http://n2t.net/addgene:162711 ; RRID:Addgene_162711)
  • For your References section:

    Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575