Skip to main content
Addgene

pCB’ CsoS2 ΔNTD
(Plasmid #162705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162705 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFE21 (derived from pZE21 under PLtet0-1 and constitutive tetR)
  • Backbone size w/o insert (bp) 3127
  • Total vector size (bp) 12000
  • Modifications to backbone
    pCB reconstructed after selection for CCMB1 growth on glycerol under ambient air
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pHnCB10 derived carboxysome operon, prk
  • Species
    H. neapolitanus and S. elongatus
  • Insert Size (bp)
    9490
  • Mutation
    Deletion of residues 2-256 of CsoS2, Y131D
  • Promoter PLtet0-1 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaaagccatccagtttactttgca
  • 3′ sequencing primer GCGTTCACCGACAAACAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Deletion of rubisco-binding N-terminus of CsoS2 prevents carboxysome formation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB’ CsoS2 ΔNTD was a gift from David Savage (Addgene plasmid # 162705 ; http://n2t.net/addgene:162705 ; RRID:Addgene_162705)
  • For your References section:

    Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575