p1A
(Plasmid #162692)

• Purpose: Expresses H. neapolitanus CbbLS and S. elongatus Prk. Rescues CCMB1 in M9 glycerol at 10% CO2
• Depositing Lab: David Savage
• Publication: Flamholz et al Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882.

Backbone

• Vector backbone: pFE21 (derived from pZE21expressing under PLtet0-1 and constitutive tetR)
• Backbone size w/o insert (bp): 3127
• Total vector size (bp): 5986
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Do not induce with aTc in LB, it will induce prk toxicity. If you want to express the genes do so in minimal media.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H. neapolitanus CbbLS and S. elongatus Prk
• Species: H. neapolitanus and S. elongatus
• Insert Size (bp): 2859
• Promoter: PLtet0-1 promoter
• Tag / Fusion Protein:
  • N terminal 6x His tag on PRK (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaaagccatccagtttactttgca
• 3′ sequencing primer: GCGTTCACCGACAAACAACA

Resource Information

• Supplemental Documents:
  • p1A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry