Skip to main content
Addgene

pFA-DAB2
(Plasmid #162690)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162690 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFA (derived from pZA31 under PLtet0-1 and constitutive tetR)
  • Backbone size w/o insert (bp) 2967
  • Total vector size (bp) 7152
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DabAB2 inorganic carbon transport complex
  • Species
    Halothiobacillus neapolitanus
  • Insert Size (bp)
    4185
  • Promoter PLtet0-1 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaacctcttacgtgccgatc
  • 3′ sequencing primer GCGTTCACCGACAAACAACA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reported in Desmarais et al. Nat. Micro. 2019.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFA-DAB2 was a gift from David Savage (Addgene plasmid # 162690 ; http://n2t.net/addgene:162690 ; RRID:Addgene_162690)

  • For your References section:

    Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575
Related items: