pFastBac1_GI.1_G131C-N172C
(Plasmid
#162586)
-
PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 6379
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVP1 protein from human norovirus GI.1
-
Alt name58 kd capsid protein [Norwalk virus]
-
SpeciesNorovirus
-
Insert Size (bp)1590
-
MutationGlycine 131 changed to Cysteine and Asparagine 172 changed to Cysteine
-
GenBank IDM87661.2
- Promoter polyhedrin
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGATTATTCATACCGTCCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1_GI.1_G131C-N172C was a gift from Peter Kwong (Addgene plasmid # 162586 ; http://n2t.net/addgene:162586 ; RRID:Addgene_162586) -
For your References section:
Disulfide stabilization of human norovirus GI.1 virus-like particles focuses immune response toward blockade epitopes. Verardi R, Lindesmith LC, Tsybovsky Y, Gorman J, Chuang GY, Edwards CE, Brewer-Jensen PD, Mallory ML, Ou L, Schon A, Shi W, Tully ES, Georgiou G, Baric RS, Kwong PD. NPJ Vaccines. 2020 Dec 14;5(1):110. doi: 10.1038/s41541-020-00260-w. 10.1038/s41541-020-00260-w PubMed 33318483