pGEX-4T-3-SpSuc1
(Plasmid
#162558)
-
PurposeExpresses GST-tagged S.pombe Suc1 in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX-4T-3
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 5310
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSchizosaccharomyces pombe Suc1
-
Alt namep13
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)342
-
Entrez Genesuc1 (a.k.a. SPBC1734.14c)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-4T-3-SpSuc1 was a gift from Iain Hagan (Addgene plasmid # 162558 ; http://n2t.net/addgene:162558 ; RRID:Addgene_162558) -
For your References section:
Highly Synchronous Mitotic Progression in Schizosaccharomyces pombe Upon Relief of Transient Cdc2-asM17 Inhibition. Singh P, Halova L, Hagan IM. Methods Mol Biol. 2021;2329:123-142. doi: 10.1007/978-1-0716-1538-6_10. 10.1007/978-1-0716-1538-6_10 PubMed 34085220