px330-Alb-1
(Plasmid
#162544)
-
PurposesgRNA targeting Alb
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang lab (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting Alb
-
gRNA/shRNA sequenceAGGAGTTTACCTTCGGGGTC
-
SpeciesM. musculus (mouse)
-
MutationNone
-
Entrez GeneAlb (a.k.a. Alb-1, Alb1, BCL002)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330-Alb-1 was a gift from Amaia Lujambio (Addgene plasmid # 162544 ; http://n2t.net/addgene:162544 ; RRID:Addgene_162544) -
For your References section:
Cooperation between distinct cancer driver genes underlies inter-tumor heterogeneity in hepatocellular carcinoma. Molina-Sanchez P, Ruiz de Galarreta M, Yao MA, Lindblad KE, Bresnahan E, Bitterman E, Martin TC, Rubenstein T, Nie K, Golas J, Choudhary S, Barcena-Varela M, Elmas A, Miguela V, Ding Y, Kan Z, Grinspan LT, Huang KL, Parsons RE, Shields DJ, Rollins RA, Lujambio A. Gastroenterology. 2020 Aug 16. pii: S0016-5085(20)35054-X. doi: 10.1053/j.gastro.2020.08.015. 10.1053/j.gastro.2020.08.015 PubMed 32814112