pFA-MNase-CaURA3
(Plasmid
#162461)
-
PurposeDNA of the 3xFLAG epitope-MNase module for C. albicans. The PacI-AscI 3xFLAG-MNase fragment was cloned in the PacI-AscI-digested pFA-TAP-CaURA3
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepFA6a
- Backbone size w/o insert (bp) 4087
- Total vector size (bp) 4628
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3FLAG-Mnase
-
SpeciesSynthetic
-
Insert Size (bp)543
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PACI (not destroyed)
- 3′ cloning site ASCI (not destroyed)
- 5′ sequencing primer AGGGTTTTCCCAGTCACG
- 3′ sequencing primer GAGCGGATAACAATTTCACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA-MNase-CaURA3 was a gift from Adnane Sellam (Addgene plasmid # 162461 ; http://n2t.net/addgene:162461 ; RRID:Addgene_162461) -
For your References section:
High-Resolution Genome-Wide Occupancy in Candida spp. Using ChEC-seq. Tebbji F, Khemiri I, Sellam A. mSphere. 2020 Oct 14;5(5). pii: 5/5/e00646-20. doi: 10.1128/mSphere.00646-20. 10.1128/mSphere.00646-20 PubMed 33055256
