pJYDNgp
(Plasmid #162453)

• Purpose: Positive control plasmid for pJYDNg carrying the eUnaG2 bilirubin dependent fluorescent protein fused to the C-terminus of Aga2p protein. This plasmid contains a long 2G linker.
• Depositing Lab: Gideon Schreiber
• Publication: Zahradník et al bioRxiv Preprint 2020

Backbone

• Vector backbone: New backbone pJYD
• Backbone manufacturer: Dr. Jiri Zahradnik
• Backbone size w/o insert (bp): 5230
• Total vector size (bp): 5231
• Modifications to backbone: Deletion of two stop codons and the addition of one nucleotide in the MCS site.
• Vector type: Shuttle vector bacteria/yeast
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Aga2p-2Glinker-eUnaG2
• Insert Size (bp): 915
• Entrez Gene: AGA2 (a.k.a. YGL032C)
• Promoter: GAL1
• Tags / Fusion Proteins:
  • HA nad myc (C terminal on insert)
  • eUnaG2 fluorescent protein (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GaL1b_F primer: CCTCTATACTTTAACGTCAAGGAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.12.16.423176v1 for bioRxiv preprint.