pJYDNp
(Plasmid
#162451)
-
PurposePositive control plasmid carrying the eUnaG2 bilirubin dependent fluorescent protein fused to the C-terminus of Aga2p protein. This plasmid serves as an expression control.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneNew backbone
-
Backbone manufacturerDr. Jiri Zahradnik
- Total vector size (bp) 5156
-
Vector typeShuttle vector bacteria/yeast
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2p-eUnaG2
- Promoter GAL1
-
Tag
/ Fusion Protein
- HA and myc
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GaL1b_F primer: CCTCTATACTTTAACGTCAAGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.16.423176v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYDNp was a gift from Gideon Schreiber (Addgene plasmid # 162451 ; http://n2t.net/addgene:162451 ; RRID:Addgene_162451) -
For your References section:
An enhanced yeast display platform demonstrates the binding plasticity under various selection pressures. Zahradník J, Dey D, Marciano S, Schreiber G. bioRxiv Preprint 2020 10.1101/2020.12.16.423176
Map uploaded by the depositor.
