CCR5-SZ190b QTY
(Plasmid
#162445)
-
PurposeExpression in E coli and perform ligand binding in solution
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET20b
-
Modifications to backboneN/A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-C chemokine receptor type 5
-
Alt nameCD195
-
SpeciesH. sapiens (human)
-
Insert Size (bp)654
-
MutationAll L, I, V, F in the transmembrane region mutated to Q, T and Y, truncation from aa88 to aa249
-
GenBank IDNM_000579.3
-
Entrez GeneCCR5 (a.k.a. CC-CKR-5, CCCKR5, CCR-5, CD195, CKR-5, CKR5, CMKBR5, IDDM22)
-
Tag
/ Fusion Protein
- his-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer aagcccgaaaggaagctgagtt
- 3′ sequencing primer aactcagcttcctttcgggctt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CCR5-SZ190b QTY was a gift from Shuguang Zhang (Addgene plasmid # 162445 ; http://n2t.net/addgene:162445 ; RRID:Addgene_162445) -
For your References section:
Non-full-length Water-Soluble CXCR4(QTY) and CCR5(QTY) Chemokine Receptors: Implication for Overlooked Truncated but Functional Membrane Receptors. Qing R, Tao F, Chatterjee P, Yang G, Han Q, Chung H, Ni J, Suter BP, Kubicek J, Maertens B, Schubert T, Blackburn C, Zhang S. iScience. 2020 Oct 28;23(12):101670. doi: 10.1016/j.isci.2020.101670. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101670 PubMed 33376963