FKBP1C-CFP-Cb5
(Plasmid
#162438)
-
Purposefor use in CIT (chemically induced trimerization) system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP1C-CFP-Cb5
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FKBP1C-CFP-Cb5 was a gift from Takanari Inoue (Addgene plasmid # 162438 ; http://n2t.net/addgene:162438 ; RRID:Addgene_162438) -
For your References section:
Rational design and implementation of a chemically inducible heterotrimerization system. Wu HD, Kikuchi M, Dagliyan O, Aragaki AK, Nakamura H, Dokholyan NV, Umehara T, Inoue T. Nat Methods. 2020 Sep;17(9):928-936. doi: 10.1038/s41592-020-0913-x. Epub 2020 Aug 3. 10.1038/s41592-020-0913-x PubMed 32747768