Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lyn-CFP-FRB1C_no-linker
(Plasmid #162434)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162434 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lyn-CFP-FRB1C_no_linker
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lyn-CFP-FRB1C_no-linker was a gift from Takanari Inoue (Addgene plasmid # 162434 ; http://n2t.net/addgene:162434 ; RRID:Addgene_162434)
  • For your References section:

    Rational design and implementation of a chemically inducible heterotrimerization system. Wu HD, Kikuchi M, Dagliyan O, Aragaki AK, Nakamura H, Dokholyan NV, Umehara T, Inoue T. Nat Methods. 2020 Sep;17(9):928-936. doi: 10.1038/s41592-020-0913-x. Epub 2020 Aug 3. 10.1038/s41592-020-0913-x PubMed 32747768