pHiFi Cas9-2×sgRNA (empty, donor)
(Plasmid #162277)

• Purpose: All-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.
• Depositing Lab: Kazuhisa Nakayama
• Publication: Fujisawa et al Biol Open. 2021 Aug 27. pii: 271969. doi: 10.1242/bio.058843.

Backbone

• Vector backbone: peSpCas9(1.1)-2×sgRNA (empty, donor)
• Backbone manufacturer: Kazuhisa Nakayama lab (Plasmid #80768)
• Backbone size w/o insert (bp): 4663
• Modifications to backbone: The eSpCas9(1.1) was replaced with the HiFi Cas9.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HiFi Cas9
• Alt name: SpCas9 (R691A)
• Species: Streptococcus pyogenes
• Insert Size (bp): 4359
• Mutation: SpCas9 (R691A)
• Tags / Fusion Proteins:
  • BPNLS (N terminal on insert)
  • BPNLS (C terminal on insert)
  • FLAG tag (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGGGATGGTTGGTTGGTGGG
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pHiFi Cas9-2xsgRNA (empty, donor).gb
• A portion of this plasmid was derived from a plasmid made by: The 1BPNLS-Cas9-1BPNLS portion of this plasmid utilized pCAG-1BPNLS-Cas9-1BPNLS (Plasmid #87108).
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry