RAPpGEX
(Plasmid
#162241)
-
PurposeExpresses LDL-receptor associated protein (RAP), full length in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX-4T1 (https://www.addgene.org/vector-database/2876/)
-
Backbone manufacturerGE Healthcare/Amersham Biosciences
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6036
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe RAP-GST fusion protein was expressed in Escherichia coli and purified via its GST tag according to standard protocols.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelrpap1
-
Alt nameLDL-receptor-related protein associated protein (RAP)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1067
-
GenBank ID16976
-
Entrez GeneLrpap1 (a.k.a. AA617339, AI790446, AU042172, C77774, HBP44, RAP)
-
Tag
/ Fusion Protein
- GST-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGATCCAGGAAGATGGCGCCTCGAAGAGA
- 3′ sequencing primer CTCGAGGACATGCTGACAGCTCCCGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full-length mouse RAP was cloned by Eva Hennen into the pGEX4T1 vector that was obtained from GE Healthcare (Amersham Biosciences).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RAPpGEX was a gift from Andreas Faissner (Addgene plasmid # 162241 ; http://n2t.net/addgene:162241 ; RRID:Addgene_162241) -
For your References section:
A LewisX glycoprotein screen identifies the low density lipoprotein receptor-related protein 1 (LRP1) as a modulator of oligodendrogenesis in mice. Hennen E, Safina D, Haussmann U, Worsdorfer P, Edenhofer F, Poetsch A, Faissner A. J Biol Chem. 2013 Jun 7;288(23):16538-45. doi: 10.1074/jbc.M112.419812. Epub 2013 Apr 24. 10.1074/jbc.M112.419812 PubMed 23615909