pJBL3664
(Plasmid #162240)

• Purpose: Transcribes E. coli SRP RNA sequence for SHAPE-Seq
• Depositing Lab: Julius Lucks
• Publication: Yu et al Mol Cell. 2021 Feb 18;81(4):870-883.e10. doi: 10.1016/j.molcel.2020.12.017. Epub 2021 Jan 15.

Backbone

• Vector backbone: p15a
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: E. coli SRP RNA
• Alt name: Signal Recognition Particle
• Species: Escherichia coli
• Promoter: J23119

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: aaatgtagcacctgaagtcagcccc

Gene/Insert 2

• Gene/Insert name: HDV
• Alt name: Hepatitis Delta Virus
• Promoter: J23119

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: aaatgtagcacctgaagtcagcccc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Authors of Watters, K., Strobel, E., Yu, A. et al. Cotranscriptional folding of a riboswitch at nucleotide resolution. Nat Struct Mol Biol 23, 1124–1131 (2016). https://doi.org/10.1038/nsmb.3316

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also referenced in: Watters, K., Strobel, E., Yu, A. et al. Cotranscriptional folding of a riboswitch at nucleotide resolution. Nat Struct Mol Biol 23, 1124–1131 (2016). https://doi.org/10.1038/nsmb.3316.

Please visit https://www.biorxiv.org/content/10.1101/379222v1 for bioRxiv preprint.