pKRG3-mU6-PUb-3xFLAG-hSpCas9
(Plasmid #162161)

• Purpose: Expresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)
• Depositing Lab: Charles Rice
• Publication: Rozen-Gagnon et al Sci Rep. 2021 Jan 12;11(1):736. doi: 10.1038/s41598-020-80436-5.

Backbone

• Vector backbone: pHW
• Backbone manufacturer: Drosophila Genomics Resource Center
• Total vector size (bp): 8896
• Vector type: Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hSpCas9
• Species: Synthetic; ; S. pyogenes
• Insert Size (bp): 4221
• Promoter: Ae. aegypti PUb
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ACGTATTTGCTCCGTCACAT

Gene/Insert 2

• Gene/Insert name: sgRNA
• Species: Synthetic
• Insert Size (bp): 193
• Promoter: Ae. aegypti U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGTGAGCTGATACCGCTCG

Resource Information

• Supplemental Documents:
  • pKRG3.gbk
• A portion of this plasmid was derived from a plasmid made by: Peter Duchek, Addgene, pDCC6
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1